Date | Compound | Laboratory | Indication | Type of Information |
---|---|---|---|---|
2015-03-02 | paclitaxel in combination with carboplatin | Celgene (USA - NJ) | first-line treatment of non-small cell lung cancer in adult patients who are not candidates for potentially curative surgery and/or radiation therapy |
Granting of a Market Authorisation in the EU |
2015-01-22 | palonosetron | Helsinn ( Switzerland) | prevention of acute nausea and vomiting associated with highly emetogenic cancer chemotherapy and prevention of nausea and vomiting associated with moderately emetogenic cancer chemotherapy in paediatric patients 1 month of age and older |
Positive opinion for the granting of a Market Authorisation in the EU |
2014-12-24 | fixed-dose combination (FDC) of nebivolol and valsartan | Actavis (Ireland) | hypertension |
Refusal of a Market Authorisation in the US |
2015-05-18 | memantine hydrochloride extended-release and donepezil hydrochloride | Actavis (Ireland) Adamas Pharmaceuticals (USA - CA) | moderate to severe dementia of the Alzheimer\'s type in patients stabilized on memantine hydrochloride and donepezil hydrochloride |
Product launch |
2014-12-23 | ivermectin | Galderma (Switzerland) | inflammatory lesions of rosacea |
Granting of a Market Authorisation in the US |
2014-12-22 | eltrombopag | GSK (UK) | paediatric patients six years and older with chronic immune (idiopathic) thrombocytopenia (ITP) who have had an insufficient response to corticosteroids, immunoglobulins or splenectomy |
Submission of an sNDA |
2018-04-13 | peramivir | BioCryst Pharmaceuticals (USA - NC) |
|
Granting of a Market Authorisation in the US |
2015-01-27 | Provepharm (France) | surgical procedures |
Product launch | |
2016-02-19 | lesinurad | AstraZeneca (UK) | hyperuricaemia associated with gout | Granting of a Market Authorisation in the EU |
2016-02-19 | brivaracetam | UCB (Belgium) | partial-onset seizures in patients from 16 years of age with epilepsy | Granting of a Market Authorisation in the US |
2014-09-08 | ibrutinib | Janssen-Cilag International - a J&J company (USA - NJ) | follicular lymphoma |
Granting of the orphan status in the US |
2014-04-30 | (3E,5E)-3,5-bis[(4-fluoro-3-nitrophenyl)methylidene]-1-(prop-2-enoyl)azepan-4-0ne | Vivolux (Sweden) | multiple myeloma |
Granting of the orphan status in the US |
2014-08-18 | Immune Globulin Subcutaneous (Human), 20% Liquid | CSL Behring (Australia) | chronic inflammatory demyelinating polyneuropathy (CIDP) |
Granting of the orphan status in the US |
2014-11-17 | N-(2-((4Z,7Z,10Z,13Z,16Z,19Z)-docosa-4,7,10,13,16,19-hexaenamido)ethyl)-2-hydroxybenzamide | Catabasis Pharmaceuticals (USA - MA) | Duchenne muscular dystrophy |
Granting of the orphan status in the US |
2014-10-15 | N-(3,4-dihydroxyphenyl)-3,4-dihydroxybenzamide | ProteoTech (USA - WA) | AL amyloidosis |
Granting of the orphan status in the US |
2014-11-24 | PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5\'TCATCATTTTGTCATTTTGTCATT 3\' | Mid-Atlantic BioTherapeutics (USA - PA) | rabies virus infections |
Granting of the orphan status in the US |
2014-11-17 | N-(9-methoxynonyl)-1-deoxynojirimycin hydrochloride | Unither Virology (USA - MD) | acute dengue illness (inclusive of acute dengue illness, dengue fever, dengue hemorrhagic fever, and dengue shock syndrome) |
Granting of the orphan status in the US |
2014-01-31 | NorLeu3-Angiotensin(1-7) [NorLeu3-A(1-7)] | US Biotest (USA - CA) | dermal injury due to nuclear/radiation incident |
Granting of the orphan status in the US |
2014-11-17 | anti-tumor necrosis factor (TNF) polyclonal antibody (bovine) | Avaxia Biologics (USA - MA) | pediatric ulcerative colitis (0 through 16 years of age) |
Granting of the orphan status in the US |
2014-02-14 | Immune Response BioPharma (USA - NJ) | pediatric HIV/AIDS (age through 16 years) |
Granting of the orphan status in the US |
© 2024 Biopharmanalyses - Powered by Samacom+